Refolding Record:

Protein See all refolding records for this protein...
Protein Name	Tousled-like kinase 1 also known as Serine/threonine-protein kinase tousled-like
Abbreviated Name	TlK1
SCOP Family	Unknown
Structure Notes
Organism	Human
UniProt Accession	Q9UKI8
SCOP Unique ID	n/a
Structure Solved
Class	Unknown
Molecularity	Unknown

Construct
Full Length	y
Domain	n/a
Chimera	n/a
Variants	n/a
Chain Length	767
Molecular Weight	86699.7
Pi	8.87
Molecular Weight	86699.7
Disulphides	Unknown
Full Sequence	MSVQSSSGSLEGPPSWSQLSTSPTPGSAAAARSLLNHTPPSGRPREGAMDELHSLDPRRQELLEARFTGVASGSTGSTGSCSVGAKASTNNESSNHSFGSLGSLSDKESETPEKKQSESSRGRKRKAENQNESSQGKSIGGRGHKISDYFEYQGGNGSSPVRGIPPAIRSPQNSHSHSTPSSSVRPNSPSPTALAFGDHPIVQPKQLSFKIIQTDLTMLKLAALESNKIQDLEKKEGRIDDLLRANCDLRRQIDEQQKLLEKYKERLNKCISMSKKLLIEKSTQEKLSSREKSMQDRLRLGHFTTVRHGASFTEQWTDGFAFQNLVKQQEWVNQQREDIERQRKLLAKRKPPTANNSQAPSTNSEPKQRKNKAVNGAENDPFVRPNLPQLLTLAEYHEQEEIFKLRLGHLKKEEAEIQAELERLERVRNLHIRELKRINNEDNSQFKDHPTLNERYLLLHLLGRGGFSEVYKAFDLYEQRYAAVKIHQLNKSWRDEKKENYHKHACREYRIHKELDHPRIVKLYDYFSLDTDTFCTVLEYCEGNDLDFYLKQHKLMSEKEARSIVMQIVNALRYLNEIKPPIIHYDLKPGNILLVDGTACGEIKITDFGLSKIMDDDSYGVDGMDLTSQGAGTYWYLPPECFVVGKEPPKISNKVDVWSVGVIFFQCLYGRKPFGHNQSQQDILQENTILKATEVQFPVKPVVSSEAKAFIRRCLAYRKEDRFDVHQLANDPYLLPHMRRSNSSGNLHMAGLTASPTPPSSSIITY
Notes	n/a

Expression
Report	Kodym R, Henöckl C, Fürweger C. (2005) Biochemical and Biophysical Research Com, 333, 411-417
Project Aim	Expression and identification
Fusion	C-terminal hexahistidine tag
Protein Expression and Production	Protein recombinantly expressed as and refolded from inclusion bodies.
Expression Host	Escherichia coli
Expression Strain	BL21(DE3)
Expression Temp	37.0
Expression Time	3 h
Expression Vector	pET32c
Expression Protocol	Expression and purification of rTlk1. The coding sequence of Tlk1 was amplified by PCR from human placental cDNA using the primers: AGCTTGATGAGTGTCCAAAG and ATATCATGCCAATCTTGGAG. The 2231 bp PCR product was cloned into the vector pCR2.1 (Invitrogen) by TA cloning. The identity of the cloned PCR product with the sequence published in GenBank under Accession No. AF162666 was verified by partial sequencing. For bacterial protein expression the insert was subcloned into the pET32c vector (Novagen) using EcoRI. The expression vector was transformed into BL21(DE3) cells and protein expression was induced by incubating the bacteria with 1 mM isopropyl-β-thiogalactopyranoside for 3 h at 37 °C.
Method of Induction	IPTG
Cell Density at Induction	OD n/a = n/a
Cell Disruption Method	None
Lytic Agent	Lysozyme
Pre-Refolding Purification	Ni-NTA agrose chromatography
Solubility	insoluble

Refolding
Refolding Method	Dialysis
Wash Buffer	n/a
Solubilization Buffer	6 M guanidine hydrochloride (GnHCl), 5 mM imidazole, 500 mM NaCl, and 20 mM Tris (pH 8.0)
Refolding Buffer	20 mM Tris (pH 8.0) buffer containing 5 mM β-mercaptoethanol
Pre-Refolding Purification	Ni-NTA agrose chromatography
Tag Cleaved	no
Refolding pH	8.0
Refolding Temperature	4.0
Protein Concentration	n/a
Refolding Time	overnight
Redox Agent	Beta-mercaptoethanol
Redox Agent Concentration	5 mM
Refolding Protocol	During this time recombinant Tlk1 fusion protein (rTlk1) accumulated in insoluble form in inclusion bodies, which were harvested after lysing the cells with 100 μg/ml lysozyme and 0.1% Triton X-100. The inclusion bodies were solubilized in a buffer containing 6 M guanidine hydrochloride (GnHCl), 5 mM imidazole, 500 mM NaCl, and 20 mM Tris (pH 8.0). The proteins were loaded on a Ni2+ column (Invitrogen) and the column was washed with solubilization buffer which had the imidazole concentration raised to 60 mM (6 M GnHCl, 60 mM imidazole, 500 mM NaCl, and 20 mM Tris (pH 8.0)). Finally rTlk1 was eluted in denatured form from the column using the solubilization buffer made with 1 M imidazole. rTlk1 was refolded by dialyzing 3 ml eluate overnight against 4 L of 20 mM Tris (pH 8.0) buffer containing 5 mM β-mercaptoethanol at 4 °C.
Refolding Assay	Mass spectrometry,Activity assay
Refolding Chaperones	None
Refolding Additives	None
Additives Concentration	n/a
Refolding Yield	n/a
Purity	n/a
Notes	n/a

Back to refolding records...