Refolding Record:
| Protein | |
|---|---|
| Protein Name | Heat shock protein 26 |
| Abbreviated Name | Hsp26 |
| SCOP Family | Unknown |
| Structure Notes | |
| Organism | Saccharomyces cerevisiae |
| UniProt Accession | P15992 |
| SCOP Unique ID | n/a |
| Structure Solved | |
| Class | Unknown |
| Molecularity | Dimer |
| Construct | |
|---|---|
| Full Length | y |
| Domain | n/a |
| Chimera | n/a |
| Variants | n/a |
| Chain Length | 213 |
| Molecular Weight | 23748.4 |
| Pi | 5.31 |
| Molecular Weight | 23748.4 |
| Disulphides | Unknown |
| Full Sequence |
sFNSPFFDFFDNINNEVDAFNRLLGEGGLRGYAPRRQLANTPAKDSTGKEVARPNNYAGALYDPRDETLDDWFDNDLSLFPSGFGFPRSVAVPVDILDHDNNYELKVVVPGVKSKKDIDIEYHQNKNQILVSGEIPSTLNEESKDKVKVKESSSGKFKRVITLPDYPGVDADNIKADYANGVLTLTVPKLKPQKDGKNHVKKIEVSSQESWGN
|
| Notes | n/a |
| Expression | |
|---|---|
| Report | Stromer T, Fischer E, Richter K, Haslbeck M, Buchner J. (2004) Biologycal Chemistry, 279, 11222-11228 |
| Project Aim | Analysis |
| Fusion | N-terminal hexahistidine tag |
| Protein Expression and Production | Protein recombinantly expressed as and refolded from inclusion bodies. |
| Expression Host | Escherichia coli |
| Expression Strain | BL21(DE3)RIL |
| Expression Temp | 1.0 |
| Expression Time | 3.5 h |
| Expression Vector | pET28b |
| Expression Protocol | Expression and Purification of Hsp26N—HSP26N was amplified from genomic yeast DNA via PCR with the primer pair TGACCATATGATTTTGGACCATGACAACAACTA, TGACGGATCCTTAGTTACCCCACGATTCTTGA and cloned into pET28b (Novagen, Madison, WI), generating an N-terminal His6 tag. The calculated molecular mass of Hsp26N is 15,281 Da. Hsp26N was expressed in the Escherichia coli strain BL21-CodonPlus (DE3)-RIL (Stratagene, La Jolla, CA). Cells were grown in Luria Bertani to A600 of 2.5 and induced with 2 mM isopropyl-1-thio--D-galactopyranoside (IPTG). After 3.5 h, cells were harvested, washed once with buffer A (40 mM sodium phosphate, 150 mM NaCl, 10 mM imidazole, pH 7.5) and lysed with a BasicZ cell disrupter (Constant Systems, Warwick, UK). |
| Method of Induction | IPTG |
| Cell Density at Induction | OD 2.5 = 600 |
| Cell Disruption Method | French Press |
| Lytic Agent | None |
| Pre-Refolding Purification | Ion-exchange chromatography |
| Solubility | soluble |
| Refolding | |
|---|---|
| Refolding Method | Dilution |
| Wash Buffer | 40 mM sodium phosphate, 150 mM NaCl, 10 mM imidazole, pH 7.5 |
| Solubilization Buffer | 40 mM HEPES/KOH, 50 mM NaCl, 1 mM EDTA, pH 8.0 |
| Refolding Buffer | 40 mM Hepes/KOH, pH 7.5 |
| Pre-Refolding Purification | Ion-exchange chromatography |
| Tag Cleaved | no |
| Refolding pH | 7.5 |
| Refolding Temperature | 25.0 |
| Protein Concentration | n/a |
| Refolding Time | 20 |
| Redox Agent | None |
| Redox Agent Concentration | n/a,n/a,n/a |
| Refolding Protocol | The cell lysate was centrifuged (46,000 x g, 45 min, 4 °C), and the soluble extract was applied to a 10-ml nickel-nitrilotriacetic acid fast flow column (Qiagen, Hilden, Germany) equilibrated in buffer A and eluted with a linear gradient of 10–300 mM imidazol. Hsp26N-containing fractions were pooled and further purified on a 26/10 Superdex 75-pg gel filtration column (Amersham Biosciences). After dialysis against buffer B (40 mM HEPES/KOH, 50 mM NaCl, 1 mM EDTA, pH 8.0), the protein was loaded on a 6-ml Resource Q ion-exchange column (Amersham Biosciences) and eluted with a linear gradient from 50–500 mM NaCl. Hsp26N-containing fractions were pooled, dialyzed against buffer B, and concentrated by ultrafiltration. Hsp26N was stored in 40 mM Hepes/KOH, 50 mM NaCl, 1 mM EDTA, pH 8.0. The correct size of Hsp26N was confirmed by matrix-assisted laser desorption ionization mass spectrometry. For refolding assays, denatured samples of Hsp26 were diluted into 40 mM Hepes/KOH, pH 7.5, containing the indicated urea concentrations and incubated for 20 h at 25 or 43 °C. |
| Refolding Assay | Unspecified |
| Refolding Chaperones | None |
| Refolding Additives | None |
| Additives Concentration | n/a |
| Refolding Yield | n/a |
| Purity | n/a |
| Notes | n/a |